Logo del repository
  1. Home
 
Opzioni

Delta6-desaturase insertion/deletion polymorphism impact on muscle fatty acid profile in Adriatic grayling (Thymallus thymallus)

RENAVILLE, Benedicte France Ghislaine
•
TULLI, Francesca
•
TIBALDI, Emilio
•
MESSINA, Maria
2012
  • conference object

Abstract
Nutritionists recommend the consumption of fish for its beneficiai properties due to the high content in long chain omega-J fatty acids (LC-PUFA), namely DHA and EPA. As fish fatty acid composition is largely inf1uenced by the diet, irrespective of species, increased synthesis of LC- PUFA is not able to compensate for the lack of dietary n-3 LC PUFA. LC-PUFA synthesis from 18:3n-3 has been shown to be increased in fish fed diets with fish oil substituted by vegetable oils through up regulation of desatura se and elongase gene expression and increased activity of the desaturationlelongation pathway has been documented in freshwater species. Fatty acid desaturase 2 (FADS2) or t>-6 desaturase is the rate limiting enzyme in the production of EPA and DHA from a-linolenic acid and is therefore a candidate gene for EPA and DHA synthesis in fish fillet. This research was aimed to study the t>6-desaturase polymorphism and its impact on muscle fatty acid profile of a freshwater fish species, the Adriatic grayling (Thymallus thymallus), chosen as fish mode!. delta6-desaturase polymorphism has been studied by using several primers for the PCR. Twenty seven specimens of Adriatic grayling, kept under controlled rearing conditions at the facilities of Udine University, were genotyped by PCR (forward primer: AAAGAAGTTGAAGTACATGCCCTA, reverse primer: AGTTCCGTTGTGAAAACATGG) and fatty acid content of fillet intramuscular fat were deterrnined by gas chromatography analysis . Single locus genotype assoc iation analyses, using the Generai Linear Mixed Model in SPSS, were carried out. Through sequencing, an insertionldeletion polymorphism was observed in the seventh intron of FADS2 and the insertion consists in 8 repeats of CTGT (32 bp). An almost significant association was found between FADS2 polymorphism and the ratio ofC18:4 n-3 to CI8:3 n-3 (P =0.088) which is the first step in the desaturation pathway. In conclusion, these preliminary results suggest that the genetic selection of Adriatic grayling with this mutation might improve its ability to utilise dietary LC-PUFA precursors and so practical diets strongly deprived of preforrned LC PUFA. It is possible to hypothesise an improvement in the utilization of vegetable meal and oil in other finfish species of aquaculture interest.
Archivio
http://hdl.handle.net/11390/868887
Diritti
closed access
Soggetti
  • FADS2

  • Genic polymorphism

  • Thymallus thymallu

  • fatty acid compositio...

google-scholar
Get Involved!
  • Source Code
  • Documentation
  • Slack Channel
Make it your own

DSpace-CRIS can be extensively configured to meet your needs. Decide which information need to be collected and available with fine-grained security. Start updating the theme to match your nstitution's web identity.

Need professional help?

The original creators of DSpace-CRIS at 4Science can take your project to the next level, get in touch!

Realizzato con Software DSpace-CRIS - Estensione mantenuta e ottimizzata da 4Science

  • Impostazioni dei cookie
  • Informativa sulla privacy
  • Accordo con l'utente finale
  • Invia il tuo Feedback